Journal: Antioxidants

Article Title: The Cytotoxicity of Doxorubicin Can Be Accelerated by a Combination of Hyperthermia and 5-Aminolevulinic Acid

doi: 10.3390/antiox10101531

Figure Lengend Snippet: Western blot analysis of each transporter expression. SLC22A16 ( A , B ), ABCG2 ( C , D ) and SLC15A1 ( E , F ) were normalized to β-actin expression. Data are expressed as the mean ± SD ( n = 3). * p < 0.05, ** p < 0.01. Student’s t -test.

Article Snippet: Antirabbit SLC22A16 (cat. no. LS-C176922) (LSBio, Seattle, WA, USA), ABCG2 (cat. no. 42078) (Cell Signaling Technology Japan K.K., Tokyo, Japan), or SLC15A1 (cat. no. bs-10588R) (Bioss, Boston, MA, USA) antibodies (1:1000) were added to the Can Get Signal ® Immunoreaction Enhancer Solution 1 (Toyobo Co. Ltd., Osaka, Japan).

Techniques: Western Blot, Expressing

Journal: Frontiers in Physiology

Article Title: Organic zinc with moderate chelation strength enhances zinc absorption in the small intestine and expression of related transporters in the duodenum of broilers

doi: 10.3389/fphys.2022.952941

Figure Lengend Snippet: Primer sequences for real-time PCR amplification.

Article Snippet: Western blotting analyses for rabbit anti-human ZnT1 (ab214356, Abcam, diluted 1:1,000), rabbit anti-mouse ZnT4 (BA3484, Boster, diluted 1:1,000), rabbit anti-human ZnT5 (25604-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human ZnT7 (13966-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human ZnT9 (BS62531, Bioworld, diluted 1:1,000), rabbit anti-human ZnT10 (ab229954, Abcam, diluted 1:1,000), rabbit anti-human ZIP3 (ab254868, Abcam, diluted 1:500), rabbit anti-human ZIP5 (ab105194, Abcam, diluted 1:1,000), rabbit anti-human B 0 AT1 (ab180516, Abcam, diluted 1:1,000), rabbit anti-human LAT1 (DF8065, Affinity Biosciences, diluted 1:500), rabbit anti-human y + LAT2 (13823-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human rBAT (DF7379, Affinity Biosciences, diluted 1:1,000) and rabbit anti-human PepT1 (A03672-1, Boster, diluted 1:500) were carried out according to the recommended protocols provided by the manufacturers.

Techniques: Real-time Polymerase Chain Reaction, Amplification, Sequencing

Journal: Frontiers in Physiology

Article Title: Organic zinc with moderate chelation strength enhances zinc absorption in the small intestine and expression of related transporters in the duodenum of broilers

doi: 10.3389/fphys.2022.952941

Figure Lengend Snippet: Effect of dietary Zn source on the mRNA expression levels of Zn, amino acid, and small peptide transporters in the duodenum of broilers at 28 days of age. Values are means ± SE, ( n = 7/8). Lacking the same letters (a, b, and c) means significant differences, p < 0.05. ZnT1, zinc transporter 1; ZnT4, zinc transporter 4; ZnT5, zinc transporter 5; ZnT7, zinc transporter 7; ZnT9, zinc transporter 9; ZIP3, Zrt-irt-like protein 3; ZIP5, Zrt-irt-like protein 5; B0AT1, B-0-system neutral amino acid co-transporter; LAT1, L-type amino acid transporter 1; y + LAT2, y + L-type amino acid transporter 2; rBAT, b0,+-type amino acid transporter; EAAT3, excitatory amino acid transporter 3; PepT1, peptide-transporter 1; Zn-Prot M, Zn proteinate with moderate chelation strength (Q f = 51.6). The mRNA expression levels were calculated as the relative quantities (RQs) of the target gene mRNA to the geometric mean of β-actin and GAPDH mRNA using the 2 −ΔΔCT method.

Article Snippet: Western blotting analyses for rabbit anti-human ZnT1 (ab214356, Abcam, diluted 1:1,000), rabbit anti-mouse ZnT4 (BA3484, Boster, diluted 1:1,000), rabbit anti-human ZnT5 (25604-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human ZnT7 (13966-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human ZnT9 (BS62531, Bioworld, diluted 1:1,000), rabbit anti-human ZnT10 (ab229954, Abcam, diluted 1:1,000), rabbit anti-human ZIP3 (ab254868, Abcam, diluted 1:500), rabbit anti-human ZIP5 (ab105194, Abcam, diluted 1:1,000), rabbit anti-human B 0 AT1 (ab180516, Abcam, diluted 1:1,000), rabbit anti-human LAT1 (DF8065, Affinity Biosciences, diluted 1:500), rabbit anti-human y + LAT2 (13823-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human rBAT (DF7379, Affinity Biosciences, diluted 1:1,000) and rabbit anti-human PepT1 (A03672-1, Boster, diluted 1:500) were carried out according to the recommended protocols provided by the manufacturers.

Techniques: Expressing

Journal: Frontiers in Physiology

Article Title: Organic zinc with moderate chelation strength enhances zinc absorption in the small intestine and expression of related transporters in the duodenum of broilers

doi: 10.3389/fphys.2022.952941

Figure Lengend Snippet: Effect of dietary Zn source on the mRNA expression levels of Zn, amino acid, and small peptide transporters in the duodenum of broilers at 39 days of age. Values are means ± SE, (n = 7/8). Lacking the same letters (a and b) means significant differences, p < 0.05. ZnT1, zinc transporter 1; ZnT4, zinc transporter 4; ZnT5, zinc transporter 5; ZnT7, zinc transporter 7; ZnT9, zinc transporter 9; ZIP3, Zrt-irt-like protein 3; ZIP5, Zrt-irt-like protein 5; B0AT1, B-0-system neutral amino acid co-transporter; LAT1, L-type amino acid transporter 1; y + LAT2, y + L-type amino acid transporter 2; rBAT, b0,+-type amino acid transporter; EAAT3, excitatory amino acid transporter 3; PepT1, peptide-transporter 1; Zn-Prot M, Zn proteinate with moderate chelation strength (Q f = 51.6). The mRNA expression levels were calculated as the relative quantities (RQs) of the target gene mRNA to the geometric mean of β-actin and GAPDH mRNA using the 2 −ΔΔCT method.

Article Snippet: Western blotting analyses for rabbit anti-human ZnT1 (ab214356, Abcam, diluted 1:1,000), rabbit anti-mouse ZnT4 (BA3484, Boster, diluted 1:1,000), rabbit anti-human ZnT5 (25604-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human ZnT7 (13966-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human ZnT9 (BS62531, Bioworld, diluted 1:1,000), rabbit anti-human ZnT10 (ab229954, Abcam, diluted 1:1,000), rabbit anti-human ZIP3 (ab254868, Abcam, diluted 1:500), rabbit anti-human ZIP5 (ab105194, Abcam, diluted 1:1,000), rabbit anti-human B 0 AT1 (ab180516, Abcam, diluted 1:1,000), rabbit anti-human LAT1 (DF8065, Affinity Biosciences, diluted 1:500), rabbit anti-human y + LAT2 (13823-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human rBAT (DF7379, Affinity Biosciences, diluted 1:1,000) and rabbit anti-human PepT1 (A03672-1, Boster, diluted 1:500) were carried out according to the recommended protocols provided by the manufacturers.

Techniques: Expressing

Journal: Frontiers in Physiology

Article Title: Organic zinc with moderate chelation strength enhances zinc absorption in the small intestine and expression of related transporters in the duodenum of broilers

doi: 10.3389/fphys.2022.952941

Figure Lengend Snippet: Effect of dietary Zn source on the protein expression levels of Zn, amino acid, and small peptide transporters in the duodenum of broilers at 28 days of age. Values are means ± SE, (n = 7/8). Lacking the same letters (a, b, and c) means significant differences, p < 0.05. ZnT1, zinc transporter 1; ZnT4, zinc transporter 4; ZnT5, zinc transporter 5; ZnT7, zinc transporter 7; ZnT9, zinc transporter 9; ZIP3, Zrt-irt-like protein 3; ZIP5, Zrt-irt-like protein 5; B0AT1, B-0-system neutral amino acid co-transporter; LAT1, L-type amino acid transporter 1; y + LAT2, y + L-type amino acid transporter 2; rBAT, b0,+-type amino acid transporter; PepT1, peptide-transporter 1; Zn-Prot M, Zn proteinate with moderate chelation strength (Q f = 51.6). The protein expression levels were calculated as the relative quantities (RQs) of the target gene protein to the β-tubulin protein.

Article Snippet: Western blotting analyses for rabbit anti-human ZnT1 (ab214356, Abcam, diluted 1:1,000), rabbit anti-mouse ZnT4 (BA3484, Boster, diluted 1:1,000), rabbit anti-human ZnT5 (25604-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human ZnT7 (13966-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human ZnT9 (BS62531, Bioworld, diluted 1:1,000), rabbit anti-human ZnT10 (ab229954, Abcam, diluted 1:1,000), rabbit anti-human ZIP3 (ab254868, Abcam, diluted 1:500), rabbit anti-human ZIP5 (ab105194, Abcam, diluted 1:1,000), rabbit anti-human B 0 AT1 (ab180516, Abcam, diluted 1:1,000), rabbit anti-human LAT1 (DF8065, Affinity Biosciences, diluted 1:500), rabbit anti-human y + LAT2 (13823-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human rBAT (DF7379, Affinity Biosciences, diluted 1:1,000) and rabbit anti-human PepT1 (A03672-1, Boster, diluted 1:500) were carried out according to the recommended protocols provided by the manufacturers.

Techniques: Expressing

Journal: Frontiers in Physiology

Article Title: Organic zinc with moderate chelation strength enhances zinc absorption in the small intestine and expression of related transporters in the duodenum of broilers

doi: 10.3389/fphys.2022.952941

Figure Lengend Snippet: Effect of dietary Zn source on the protein expression levels of Zn, amino acid, and small peptide transporters in the duodenum of broilers at 39 days of age. Values are means ± SE, (n = 7/8). Lacking the same letters (a and b) means significant differences, p < 0.05. ZnT1, zinc transporter 1; ZnT4, zinc transporter 4; ZnT5, zinc transporter 5; ZnT7, zinc transporter 7; ZnT9, zinc transporter 9; ZIP3, Zrt-irt-like protein 3; ZIP5, Zrt-irt-like protein 5; B0AT1, B-0-system neutral amino acid co-transporter; LAT1, L-type amino acid transporter 1; y + LAT2, y + L-type amino acid transporter 2; rBAT, b0,+-type amino acid transporter; PepT1, peptide-transporter 1; Zn-Prot M, Zn proteinate with moderate chelation strength (Qf = 51.6). The protein expression levels were calculated as the relative quantities (RQs) of the target gene protein to the β-tubulin protein.

Article Snippet: Western blotting analyses for rabbit anti-human ZnT1 (ab214356, Abcam, diluted 1:1,000), rabbit anti-mouse ZnT4 (BA3484, Boster, diluted 1:1,000), rabbit anti-human ZnT5 (25604-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human ZnT7 (13966-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human ZnT9 (BS62531, Bioworld, diluted 1:1,000), rabbit anti-human ZnT10 (ab229954, Abcam, diluted 1:1,000), rabbit anti-human ZIP3 (ab254868, Abcam, diluted 1:500), rabbit anti-human ZIP5 (ab105194, Abcam, diluted 1:1,000), rabbit anti-human B 0 AT1 (ab180516, Abcam, diluted 1:1,000), rabbit anti-human LAT1 (DF8065, Affinity Biosciences, diluted 1:500), rabbit anti-human y + LAT2 (13823-1-AP, Proteintech, diluted 1:1,000), rabbit anti-human rBAT (DF7379, Affinity Biosciences, diluted 1:1,000) and rabbit anti-human PepT1 (A03672-1, Boster, diluted 1:500) were carried out according to the recommended protocols provided by the manufacturers.

Techniques: Expressing

Journal: Oncotarget

Article Title: Targeting PEPT1: a novel strategy to improve the antitumor efficacy of doxorubicin in human hepatocellular carcinoma therapy

doi: 10.18632/oncotarget.17117

Figure Lengend Snippet: The expression of PEPT1 in liver normal cell line HL-7702, hepatocarcinoma cell lines (Bel-7402, HepG2) and human colon cancer cell line Caco-2 by Western blotting ( A ) and Real-time RT-PCR ( B ). The expression of PEPT1 based on immunohistochemistry in different liver tissues ( C , D ): The uptake of Ala-Lys-AMCA under different conditions, from left to right was the uptake at different times (0, 15, 30, 60, 120, 180 min), at different pH values (5.4, 6, 7.4, 8.4), at different concentrations (25 μmol/L, 50 μmol/L, and 150 μmol/L) and at diffrernt inhibitors (a: without inhibitor, b with inhibitor Gly-Sar, c: with inhibitor Gly-Sar, Gly-Gln, d: with inhibitor Gly-Gly-Gly).

Article Snippet: A rabbit polyclonal antibody to SLC15A1 (anti-PEPT1 antibody) was provided by Abcam.

Techniques: Expressing, Western Blot, Quantitative RT-PCR, Immunohistochemistry, Ubiquitin Proteomics

Journal: Oncotarget

Article Title: Targeting PEPT1: a novel strategy to improve the antitumor efficacy of doxorubicin in human hepatocellular carcinoma therapy

doi: 10.18632/oncotarget.17117

Figure Lengend Snippet: ( A ) The drug distribution in different tissues of mice of different group, 1: tumor, 2: liver, 3: heart, 4: jejunum. a: Control group, b: Doxorubicin-tripeptide conjugate group, c: Doxorubicin group. ( B ) The cardiac pathology in each group (×200), a: Control group, b: Doxorubicin-tripeptide conjugate group, c: Doxorubicin group. ( C ) The bone marrow smear in each group (×200), a: Control group, b: Doxorubicin-tripeptide conjugate group, c: Doxorubicin group. ( D ) The expression of PEPT1 in different tissues of mice (×200), 1: tumor, 2: liver, 3: heart, 4: jejunum.

Article Snippet: A rabbit polyclonal antibody to SLC15A1 (anti-PEPT1 antibody) was provided by Abcam.

Techniques: Control, Expressing

Journal: Yonago Acta Medica

Article Title: Oligopeptide Transporter-1 is Associated with Fluorescence Intensity of 5-Aminolevulinic Acid-Based Photodynamic Diagnosis in Pancreatic Cancer Cells

doi: 10.33160/yam.2020.08.003

Figure Lengend Snippet: Protein expression levels of PEPT-1 in hPDECs, MIA PaCa-2, and AsPC-1 cells. (A) Representative image of western blot for PEPT-1 and β-actin in hPDECs, MIA PaCa-2, and AsPC-1 cells. (B) Quantitative analyses of the western blots for PEPT-1 protein from 3 repetitive experiments. The signal intensity was normalized to the β-actin protein level and expressed as relative expression levels in hPDECs. Bars indicate average ± SEM. *P < 0.05 compared to hPDECs. One-way ANOVA followed by post hoc Tukey test. hPDEC, human pancreatic duct epithelial cell; PEPT-1, oligopeptide transporter-1.

Article Snippet: 22 The forward and reverse primer sequences used in this study are summarized in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Symbol Forward primer Reverse primer PEPT-1 5’- TCACCTGTGGCGAAGTGGTC -3’ 5’- GCCACGATGAGCACAATGATG -3’ ABCB6 5’- TTCACTGTGATGCCTGGACAGA -3’ 5’- GGATGCAGCCAGAGCTGATG -3’ ABCG2 5’- GCAACCATCAATTCAGGTCAAGA -3’ 5’- GAAACACAACACTTGGCTGTAGCA -3’ PBGS 5’-AACCAGCATAAATACTGCCTGAGGA -3’ 5’- TGGCACCTCTAGCAGTCAGGAA -3’ PBGD 5’-AACAGCCCAAAGATGAGAGTGATTC -3’ 5’- AATGTTGCCACCACACTGTCC -3’ UROS 5’- CCTGAACAGCTACTATTCCGAGCA -3’ 5’- CTTGAGACTGTATGTGAGGCCAGAG -3’ UROD 5’- CCCTGTGCCTTGTATGCATCTG -3’ 5’- TGTAGCGATGTGGTCCAAAGTCA -3’ CPOX 5’- CACTCCAGGATCCAGAATTGAAAG -3’ 5’- TGCATCAACGCACCCAGTC -3’ PPOX 5’- GCCCTTGAAACCCACCTGACTA -3’ 5’- ACTAATAACGTGGTCAGCCTCCAGA -3’ FECH 5’- AGGCCATTAAGATGGATGTTGGAA -3’ 5’- CTGTCAGAGTGAAGGCTCACAAGAA -3’ β-actin 5’- GCATCCTCACCCTGAAGTA -3’ 5’- TGTGGTGCCAGATTTTCTCC -3’ Open in a separate window ABC, the ATP-binding cassette; CPOX, coproporphyrinogen oxidase; FECH, ferrochelatase; PBGD, porphobilinogen deaminase; PBGS, porphobilinogen synthase; PEPT-1, oligopeptide transporter-1; PPOX, protoporphyrinogen IX oxidase; UROD, uroporphyrinogen III decarboxylase; UROS, uroporphyrinogen III synthase. caption a8 Primer sequences for quantitative reverse transcription-PCR Western blot analysis The rabbit polyclonal anti-PEPT-1 antibody (Abcam PLC., Tokyo, Japan), rabbit monoclonal anti-β-actin (D6A8) antibody (CST Japan Co., Ltd, Tokyo, Japan), and horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG H&L (Abcam PLC., Tokyo, Japan) were used.

Techniques: Expressing, Western Blot

Journal: Nutrients

Article Title: Resveratrol Inhibits Porcine Intestinal Glucose and Alanine Transport: Potential Roles of Na + /K + -ATPase Activity, Protein Kinase A, AMP-Activated Protein Kinase and the Association of Selected Nutrient Transport Proteins with Detergent Resistant Membranes

doi: 10.3390/nu10030302

Figure Lengend Snippet: Representative Western blots of ( a ) the non-DRM marker Na + /K + -ATPase ( b ) the DRM marker flotillin-1 (Flot-1) and the transport proteins SGLT1 ( c ), PEPT1 ( d ), NHE3 ( e ) and phosphorylated NHE3 at Serin522 ( f ) and Serin605 ( g ) in non-DRM and DRM fractions prepared from jejunal or ileal tissues after treatment with resveratrol (10 µM or 300 µM, 30 min).

Article Snippet: Additionally, the following primary antibodies and conditions were used: NHE3: denaturing at RT for 20 min, primary antibodies: rabbit-anti-NHE3 (sc-16103-R, Santa Cruz Biotechnology, Dallas, TX, USA), mouse-anti-NHE3 Ser552 (NB110-81529, Novus Biologicals, Littleton, CO, USA, mouse-anti-NHE3 Ser605 (NB110-74678SS, Novus Biologicals); PEPT1, Na + /K + -ATPase, flotillin-1: denaturing at 95 °C for 5 min, goat-anti-PEPT1 (19917, Santa Cruz), mouse-anti-Na + /K + -ATPase (ALX-804-082, Enzo life Sciences, New York, NY, USA), rabbit-anti-flotillin-1 (3253, Cell Signaling).

Techniques: Western Blot, Marker

Journal: Nutrients

Article Title: Resveratrol Inhibits Porcine Intestinal Glucose and Alanine Transport: Potential Roles of Na + /K + -ATPase Activity, Protein Kinase A, AMP-Activated Protein Kinase and the Association of Selected Nutrient Transport Proteins with Detergent Resistant Membranes

doi: 10.3390/nu10030302

Figure Lengend Snippet: Association of transport proteins with the DRM fraction prepared from jejunal and ileal apical membranes after incubation with resveratrol (300 µM, 30 min) expressed as changes (means ± SD) in the protein/flotillin-1 ratio. The change in protein/flotillin-1 ratio was calculated (the protein/flotillin-1 ratio for resveratrol-treated tissues was set in relation to preparations from control tissues ( n = 6, n = 4 for pNHE3 Ser605 Ileum)).

Article Snippet: Additionally, the following primary antibodies and conditions were used: NHE3: denaturing at RT for 20 min, primary antibodies: rabbit-anti-NHE3 (sc-16103-R, Santa Cruz Biotechnology, Dallas, TX, USA), mouse-anti-NHE3 Ser552 (NB110-81529, Novus Biologicals, Littleton, CO, USA, mouse-anti-NHE3 Ser605 (NB110-74678SS, Novus Biologicals); PEPT1, Na + /K + -ATPase, flotillin-1: denaturing at 95 °C for 5 min, goat-anti-PEPT1 (19917, Santa Cruz), mouse-anti-Na + /K + -ATPase (ALX-804-082, Enzo life Sciences, New York, NY, USA), rabbit-anti-flotillin-1 (3253, Cell Signaling).

Techniques: Incubation, Control